circad | circRNAs associated with diseases

hsa_circ_0103809
Gene	AP4E1	Organism	Human
Genome Locus	chr15:51242247-51250991:+	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	30018710
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	Seventy-eight pairs of HCC tissues and corresponding adjacent normal tissues were acquired from patients underwent surgical operation
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGCTTCCAGTTGACAGGAGT Reverse TCTCTGTGGATAGAACACATTTTCC	Statistics	Fold Change : Upregulation,12.56 pvalue : p=0.00000725
Citation
Cai, H, Hu, B, Ji, L, Ruan, X, Zheng, Z (2018). Hsa_circ_0103809 promotes cell proliferation and inhibits apoptosis in hepatocellular carcinoma by targeting miR-490-5p/SOX2 signaling pathway. Am J Transl Res, 10, 6:1690-1702.